Powered by SafeDNA API

Biosecurity
Intelligence Platform

Two powerful tools for modern biosecurity compliance — real-time DNA sequence hazard screening and AI-powered dual-use research risk analysis.

LIVE SEQUENCE ANALYSIS
ATGAAAGCAATTTTTGTCTTGTTCGCTGTGCTTTCTTCAGTTGTTTCAGCATCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAATGAAAGCAATTTTTGTCTTGTTCGCTGTGCTTTCTTCAGTTGTTTCAGCATCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAATGAAAGCAATTTTTGTCTTGTTCGCTGTGCTTTCTTCAGTTGTTTCAGCATCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAATGAAAGCAATTTTTGTCTTGTTCGCTGTGCTTTCTTCAGTTGTTTCAGCATCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
GRANTED
10M+
Sequences Screened
<2s
Average Response Time
99.9%
Uptime SLA
180+
Countries Supported
DNA Sequence Screening

Screen sequences for
biosecurity hazards

Submit any DNA sequence and receive an instant synthesis permission decision — Granted or Denied — backed by the SafeDNA hazard database covering select agents, toxins, and potential pandemic pathogens. Your sequences are never exposed thanks to cryptographic privacy protocols.

1
Paste your FASTA sequence or raw nucleotides
2
Cryptographic screening against the SafeDNA hazard database
3
Receive synthesis permission with full hazard breakdown
4
Download PDF report or share a secure link with collaborators
pUC19 PlasmidSynthesis Granted
ATGAAAGCAATTTTTGTCTTGTTCGCTGTGCTTTCTTCAG
0 hazard hits · 2,686 bp · 1.2s
Unknown SequenceSynthesis Denied
GAATCGCAATTAACAATAACTAAAGAGAAAAAAGAAGAAC
2 hazard hits·Influenza A (H1N1) · SelectAgent
HIT REGION MAP
0 bp5,000 bp10,000 bp

Real-Time Hazard Detection

Instantly screen against the SafeDNA hazard database covering select agents, toxins, and potential pandemic pathogens.

Cryptographic Privacy

Your sequences are never exposed. SafeDNA uses cryptographic protocols so hazard databases can be queried without revealing sequence content.

Interactive Visualizations

Explore results with hit region maps, organism breakdowns, and nucleotide-level hazard annotations.

PDF & JSON Reports

Download formatted PDF reports for compliance records or export machine-readable JSON for downstream workflows.

Full Screening History

Audit trail of all screening requests with filterable history, status tracking, and result archiving.

Secure Share Links

Generate time-limited shareable links to send results to external collaborators without requiring login.

DURC Identification

Identify dual-use research
before it causes harm

Upload a research paper, lab protocol, or proposal and our AI engine evaluates it against all 15 US Policy DURC categories — detecting research that could be misused to enhance pathogen transmissibility, virulence, drug resistance, or immune evasion.

1
Upload PDF, DOCX, or paste research text (multi-language OCR supported)
2
AI engine evaluates against 15 DURC categories
3
Receive a risk score (0–100) with concern evidence
4
Download ethics board report with safety recommendations
H5N1 Transmission Study
Research Paper · 24 pages
CRITICAL RISK
0 — Safe87 / 100100 — Critical
Enhanced transmissibility via gain-of-function
Airborne transmission potential identified
Vaccine resistance implications
SAFETY RECOMMENDATIONS
Escalate to BSL-4 containment level
Restrict access to cleared personnel only
Remove transmission data before publication
Submit for institutional ethics review

AI-Powered Risk Assessment

Large language model evaluates research against all 15 US DURC policy categories with evidence-backed concern identification.

Multi-Format Document Upload

Upload PDF or DOCX files with automatic text extraction. Scanned documents are processed via Tesseract OCR.

Multi-Language OCR

Extract text from scanned PDFs in English, French, German, and Arabic with confidence scoring per language.

0–100 Risk Score

Quantified risk score with Low / Medium / High / Critical classification and visual gauge for instant comprehension.

Prioritized Recommendations

Actionable safety recommendations ranked by priority — from lab containment upgrades to publication redaction guidance.

Ethics Board PDF Reports

Generate formatted PDF reports with risk score, concern evidence, and recommendations ready for institutional ethics review.

Infohazard Analysis

Detect information hazards
before public release

Upload or paste any scientific manuscript and our AI engine scans it for information hazards — passages that could enable harm if widely disseminated — using Nick Bostrom's 10-type infohazard taxonomy. It flags each passage and rewrites it in safe, public-friendly language.

1
Paste text or upload a .txt / .md manuscript (up to 50,000 chars)
2
AI classifies each passage across 10 Bostrom infohazard types
3
Receive severity ratings (Low / Medium / High / Critical) per passage
4
Get a safe science communication rewrite + downloadable PDF report
Gain-of-Function Manuscript
Research Paper · 3 passages flagged
HIGH RISK
Template Hazardhigh

“We synthesized the pathogen using the following step-by-step protocol...”

Data Hazardmedium

“The agent demonstrated 95% lethality in the murine model at 10³ PFU...”

Idea Hazardlow

“Our findings suggest airborne transmission could be achieved by...”

SAFE COMMUNICATION ALTERNATIVE

“We characterized the pathogen using established laboratory methods consistent with BSL-3 protocols. Virulence parameters were assessed in accordance with institutional biosafety guidelines.”

✓ Safe for public science communication

Bostrom 10-Type Taxonomy

Classifies passages across all 10 infohazard types: data, idea, template, attention, signaling, evocation, enemy, competitiveness, development, and norm hazards.

Safe Language Suggestions

For every flagged passage, the AI generates a safer science communication alternative that conveys the scientific finding without the hazardous specificity.

Passage-Level Severity

Each flagged passage receives an individual severity rating (Low / Medium / High / Critical) with a detailed explanation of why it poses a risk.

Safe Communication Version

Generates a complete safe public communication version of the manuscript summary — ready for press releases, lay summaries, and public outreach.

Downloadable PDF Report

Export a structured PDF report with all flagged passages, hazard types, safe alternatives, and mitigation advice for ethics board or institutional review.

Mitigation Guidance

Each flagged passage includes specific mitigation advice — from redaction recommendations to suggested institutional review steps and publication restrictions.

Three tools, one platform

Choose the right tool for your biosecurity workflow.

DNA Sequence Screening
For synthesis providers & researchers
Submit FASTA or raw nucleotide sequences
Instant synthesis permission decision
Nucleotide-level hazard hit mapping
Organism & accession number details
Shareable result links for collaborators
Full audit history & queue management
Infohazard Analysis
For science communicators & authors
Paste text or upload manuscript (.txt / .md)
10-type Bostrom infohazard classification
Severity rating per flagged passage
Safe science communication alternatives
Full safe public communication version
Downloadable PDF infohazard report
DURC Identification
For IRBs, ethics boards & institutions
Upload PDF, DOCX, or paste research text
AI analysis against 15 DURC categories
0–100 risk score with severity classification
Evidence-backed concern identification
Prioritized safety recommendations
Ethics board PDF report generation

Built for serious biosecurity work

All three tools share enterprise-grade infrastructure.

End-to-End Security
Cryptographic privacy on all sequence data
Role-Based Access
Admin and user roles with granular permissions
Full Audit Trail
Complete history of all analyses and actions
Real-Time Processing
Sub-2 second response times on all requests
Infohazard Detection
Bostrom 10-type taxonomy applied to manuscripts
Safe Language Rewrites
AI-generated public-safe alternatives per passage
Smart Contract Insurance

Automated Compliance Enforcement

Every DURC analysis at Medium risk or above automatically generates a binding smart contract, calculates an insurance premium, and opens an escrow account — creating an immutable, auditable compliance trail.

How the system works

01

Contract Auto-Generation

When a DURC analysis completes at Medium risk or above, a smart contract is instantly created with a composite risk score derived from technical complexity, accessibility, misuse potential, and consequence severity.

02

Insurance Premium Calculation

A risk-adjusted insurance premium is calculated using base rate × risk score × exposure factor × compliance multiplier. Coverage amounts scale from $50,000 (Medium) to $2,000,000 (Critical) research.

03

Escrow Account & Deposits

An escrow account is opened per researcher. Penalty deductions are made automatically when violations are filed. Balances are visible in real time on the Smart Contract Dashboard.

04

Immutable Audit Ledger

Every contract event — creation, activation, violation, resolution — is appended to a hash-chained audit ledger. Each block references the previous hash, making the record tamper-evident and fully auditable.

4-Tier Penalty Framework

Violations are classified into four escalating tiers based on severity. Penalties are deducted directly from the researcher's escrow account.

Tier 1Warning
$500
−5 pts

Minor procedural non-compliance. Formal written warning issued. Corrective action plan required within 30 days.

Tier 2Moderate
$2,500
−15 pts

Significant policy violation. Financial penalty + mandatory biosafety training. Research may be paused pending review.

Tier 3Serious
$10,000
−30 pts

Serious breach of DURC obligations. Research suspended. Institutional review board notified. Regulatory reporting may be required.

Tier 4Critical
$50,000
−100 pts

Critical violation with potential public safety implications. Maximum financial penalty. Permanent platform exclusion. Mandatory regulatory disclosure.

Auto
Contract Generation
Risk-Adj.
Insurance Premiums
Escrow
Penalty Enforcement
Immutable
Audit Ledger

Smart contracts are automatically created for Medium, High, and Critical DURC analyses.

Institutional Access

Request Institutional Access

Universities, research institutes, and biosafety committees can request institutional licensing, API integration, or a live demo. We respond within 2 business days.

0/5000

By submitting this form you agree to be contacted by the SafeDNA team. We do not share your information with third parties.

FAQ

Questions & Answers

Everything you need to know about SafeDNA, biosecurity screening, and DURC compliance.

Start screening today

Free access to DNA Sequence Screening, DURC Analysis, and Infohazard Detection. Sign in to get started.